| Nahlásit

Gen, úloha

Mohla bych poprosit o radu? Nevím si rady s tímto úkolem. Děkuji za pomoc

Gen je tvořen následujícím pořadím (sekvencí) nukleotidů:
AATACCTGACGGGATGGAAAATAT
Třetí kodon v molekule mRNA odvozený z genu je tvořen nukleotidy?
Témata: biologie

Reakce

 Anonym
Odpovídat lze i bez registrace. Dodržujte pravidla Ontoly
Vložit: Obrázek